* NAS continues to participate in the FBI’s stonewalling efforts to keep the truth about the 2001 anthrax attacks away from public scrutiny
Posted by DXer on January 15, 2010
On December 8, 2009, I wrote to NAS spokesperson Willian Kearney as follows …
BILL … It is utterly incredible to me, and very disappointing, that you, and thus the NAS, have simply ignored the questions I have asked regarding the FBI-submitted information. If you have reasons for not releasing information, why not state them? Do you have any intention of ever responding, even if only to tell me that in your judgment my questions are inappropriate? … LEW
This was in followup to questions posed in prior emails …
- Could you please provide an update on current NAS intentions by answering the following questions …
- Does NAS still plan to withhold some or all FBI-submitted documents until the end of the study?
- If so, will NAS provide a list of withheld FBI-submitted documents?
- If NAS is planning to withhold some or all FBI-submitted documents until the end of the study but release them at that time, what legal authority does NAS cite for doing so?
- Will NAS provide a list of any FBI-submitted documents which NAS is intending to permanently restrict from access, indicating in each case the specific exemption which is being cited to justify that action?
To date, there has been no response to my December 8 email. NAS has apparently decided to participate in the FBI’s stonewalling efforts to keep the truth about the 2001 anthrax attacks away from public scrutiny, regardless of the laws regarding disclosure of information.
******
CASE CLOSED is a novel which answers the question … Why did the FBI fail to solve the 2001 anthrax case?
Here’s an early discussion by the (fictional) DIA team investigation the FBI anthrax investigation …
“Let’s start with the assumption the Bureau is not dumb,” Sowickey began. “So that can’t be the excuse for the lamebrain way they conducted this supposedly high priority investigation. Nor can it explain the way they failed to establish links between pieces of information they clearly had. Nor why they hinted for years that Farmer was the perp and then gave him $5.8 mil to go away. There was, by the way, even less evidence implicating Dr. Farmer than there was on Dr. Ingram, which is close to nothing. After seven years.”
Click here to … buy CASE CLOSED by Lew Weinstein
CASE CLOSED ... what really happened in the 2001 anthrax attacks? 
DXer said
A new book December 2009 Biosecurity: Origins, Transformations and Practices (New Security Challenges) by Brian Rappert and Chandr Gould (Hardcover – Dec 8, 2009) states:
“The emerging threat of terrorism has also alerted the public to the potential capability of non-state actors to harm state and society, enabled by the proliferation of various dual-use technologies through globalisation. This is especially the case in relation to the anthrax letter incidents in the US, which followed the Al Qaeda’s terrorist attacks on the United States on September 11, 2001. These events dramatically altered Japan’s threat perception of non-state actors’ acquisition of WMD-related materials and technologies. Later in 2008, the US Federal Bureau of Investigation concluded that it was former US Army researcher Bruce Ivins, not an Al-Qaeda terrorist, who appeared as the suspect in the anthrax incidents (although many of his former colleagues expressed dissenting views, arguing that the FBi’s conclusion was wrong). In any case, these anthrax incidents are viewed as representing the possibility of how individuals can misuse biological agents to cause a panic in many countries around the world.”
In the year and a half since August 2008, no new evidence has come out tending to incriminate Dr. Ivins.
The Federal Eagle envelope issue is more probative than even the genetics, which merely narrow the field to 100-300 from 1000, and yet the NAS does not even address it in a review of the science being relied upon by the FBI.
Not even the NAS report, if it validates the FBI’s science, will have advanced things. The conclusion that the FBI had not made its case typically credited the science and found that it did not get the FBI down the field.
As another example, by failing to consider the isotope issue, the NAS did not review the FBI’s science. The FBI’s conclusion that it was not “relevant” was precisely a key conclusion that needed review.
DXer said
Development of an Aerosol System for Uniformly Depositing Bacillus Anthracis Spore Particles on Surfaces
Authors: Paul A. Baron a; Cherie F. Estill a; Gregory J. Deye a; Misty J. Hein a; Jeremy K. Beard b; Lloyd D. Larsen b; Gregory E. Dahlstrom b
Affiliations: a Centers for Disease Control and Prevention, National Institute for Occupational Safety and Health, Cincinnati, Ohio, USA
b Dugway Proving Ground, Dugway, Utah, USA
Published in: Aerosol Science and Technology, Volume 42, Issue 3 March 2008 , pages 159 – 172
When the authors, at the end of this article, show a “Particle assumed to contain a spore coated with fumed silica,”
what is Ed’s basis for his use of the word “coated” to exclude microencapsulation?
Is what remains of Ed’s argument, after his egregious confusion about the genetics and silica generally is overlooked, a matter of semantics centering on the word “coated”?
Does Sandia’s argument similarly rest on wordplay? (“we could argue all day about what ‘naturally occurring’ means”).
DXer said
http://www.time.com/time/nation/article/0,8599,1954598,00.html
“At the time of her arrest she allegedly had with her a flash drive with references to specific “cells” and “enemies,” and various chemicals cached in cold cream jars, including a quantity of sodium cyanide.
***
According to the indictment, Siddiqui was found with documents that referred to a “mass casualty attack,” and listed potential targets like the Empire State Building, alongside notes that mention “dirty bombs” and attacks using gliders.”
Comment:
The FBI’s analysis in Amerithrax sometimes seemed like a 90 pound woman struggling to aim a automatic weapon.
Contrary to the pundits who just associate Al Qaeda with a “big bang,” a key modus operandi of the Vanguards of Conquest was targeted assassination and it was widely known known that Zawahiri was seeking to weaponize anthrax for use against US targets. The Egyptian Islamic Jihad group specializes in armed attacks against high-level Egyptian government officials, including Cabinet ministers. The group had a “hit list” that included tens of Egyptians to be killed by the group, including journalists. In May 1987, a Major General was shot outside his home in Cairo. Several EIJ members and two Islamist Group members were arrested in connection with the attack. In November 1990, six members of EIJ were arrested in connection with the murders of People’s Assembly Speaker and five security men on October 12, 1990. The EIJ’s military wing, the Vanguards of Conquest, launched a violent campaign in March 1992. Of 223 killed in the first year or two, 67 were policemen, 76 were Islamic militants, 36 were civilian Christian Copts, and three were foreign tourists. Prosecutors and policemen would be targeted to avenge torture. By April 1995, 700 had been killed. Al-Jihad has had a role in most foreign terrorist attacks against the United States and its allies over the past 20 years. The group is most well known for its first, the 1981 assassination of Egyptian President Anwar Sadat.
In August 1993, the same year as the bombing of the World Trade Center, al-Jihad attempted to assassinate Egyptian Interior Minister by firing on his motorcade and detonating a homemade bomb. The group also made an attempt that year against Prime Minister with an explosion which occurred about 500 yards from his home as his motorcade passed. A 15-year-old girl standing at a nearby bus stop was killed. EIJ issued a statement claiming the action was to avenge the recent death sentences. In 1992, Islamic Jihad activists murdered an author, Faraj Fodah, who had openly supported Israeli-Egyptian peace. The secular columnist in his last article had suggested that the militants were motivated by sexual frustration more than politics. In March 1994 Egypt’s higher military Court passed death sentences in absentia that included Tharwat Salah Shehata, Yasser al-Sirri, ‘Isam Muhammad ‘Abd-al-Rahman for the assassination attempt on Prime Minister Sedki on November 25, 1993. In 1994 al-Jihad militants were linked to two unsuccessful attempts to bomb the Israeli and U.S. embassies in Manila. In June 1995, the Vanguards of Conquest claimed responsibility for a failed assassination attempt on Egyptian President Hosni Mubarak to kill Egyptian President Hosni Mubarak in Addis Ababa, Ethiopia. In November 1995, an EIJ suicide car bombing of the Egyptian Embassy in Islamabad, Pakistan killed 17 and injured 59. An Egyptian with Canadian citizenship, Ahmad Saeed Kadr (Khadr), was charged in connection with the bombing. Kadr worked as the regional director of Human Concern International, a Canadian relief agency in Peshawar, and was alleged to have moved money through the aid agency from Afghanistan to Pakistan to pay for the operation. In December 1995, the Vanguards of Conquest sent a communiqué warning Pakistan to stop extraditing militants to Egypt, or “it will pay a heavy price.” That month, Egyptian Security forces arrested 56 terrorists after being tipped off by an EIJ informer. The group was accused of planning to assassinate President Hosni Mubarak on 1995 using 550 pounds of explosives to blow up the President’s motorcade.
In November 1997 after the killing in Luxor, Egypt, of 58 tourists by Al Gamaa Al Islamiyaa, the Vanguards of Conquest warned that orders had “already been given for attacks on Americans and Zionists not only in Egypt but elsewhere.” In February 1998 Al Jihad was one of the founding signatories involved in the creation of the World Islamist Front for the Jihad against Jews and the Crusaders (World Islamist Front). The Front subsequently issued a fatwa calling for the killing of Americans worldwide and the expulsion of Americans from the holy land and Jews from Jerusalem. Egyptian Islamist sources declared that the release of the statement marked Al Zawahiri’s, and Al Jihad’s, return to the field of active terrorist groups.
In June 1998 Egyptian security authorities arrest seventeen members on charges of forming an Al Jihad cell in east Cairo. Resulting confessions revealed that Al Jihad was planning to assassinate a number of public figures and security officers. That month, Jihad members al-Najjar (head of Al Jihad in Albania), and Majed Mustapha were arrested in Albania, reportedly with the aid of the Central Intelligence Agency, and extradited to Egypt in late June 1998. An August 1998 Statement issued by the Information Office of the Jihad Group in Egypt vowed revenge on the United States for the extradition of three Al Jihad members from Albania to Egypt.
In September 1998, a number of senior EIJ and IG leaders in London were arrested, including the EIJ cell members who had faxed the claim of responsibility for the embassy bombings. In April 1999, after verdicts in the “Returnees from Albania,” the Vanguards of Conquest and Al Jihad issue separate threats of retaliation. Of the 107 accused, 87 defendants were found guilty, including Canadian Mahmoud Mahjoub. The day of the bombing, shortly after the explosions, EIJ military commander Mabruk called Canadian VOC member Jaballah and told him to call the London cell members and tell them he could be reached at Shehata’s residence. Shehata was Jaballah’s brother-in-law. The London cell members then issued a claim of responsibility for the blasts. That year, the group also planned an unsuccessful attack on the U.S. Embassy in Albania.
Throughout these years, an estimated 70 Egyptian militants were rendered by the US to Cairo prior to 9/11 and the anthrax mailings. The fact that targeted assassination was the modus operandi of the US-based islamists — and that the motivation was retaliation for the detention of senior leaders and to create leverage aimed at their release — was established by the first of a series of terrorist attacks in the US — the assassination of radical rabbi Meir Kahane by Egyptian Nosair, who had emigrated from Egypt in 1981. In his address book, Nosair had written the names of some Jewish officials, to include two judges who recently had extradited an Arab terrorist. Nosair’s job had been to protect the blind sheikh in the US. He was a friend of Ali Mohammed who stayed with him when he came to New York. The commentators who argued that Al Qaeda just goes for the “big bang” were overlooking the modus operandi of the Vanguards and what was known about Ayman’s biological program through “open source” materials.
In his March 2007 confession to a military tribunal, KSM admitted to having been involved in a plot to assassinate a number of former American presidents (including Jimmy Carter), Pope John Paul II and Pakistani President Pervez Musharraf. In December 2007, Benazir Bhutto was assassinated. In January 2008, it was revealed that Jabarah, the go-between KSM and Hambali had vowed to avenge the death of a friend by killing FBI agents and prosecutors he knew and apparently intended to use some steak knives he had secreted. To suggest that Zawahiri and his colleagues do not use targeted assassination as their modus operandi — indeed, to not appreciate that it is the EIJ’s key modus operandi — totally misses the mark.
DXer said
Reputed al-Qaida supporter set for NYC trial
By TOM HAYS
The Associated Press
Monday, January 18, 2010
http://www.washingtonpost.com/wp-dyn/content/article/2010/01/18/AR2010011802122.html
Did Al Qaeda operative Aafia Siddiqui’s research into germ warfare or work as a lab technician expose her to the use of silica or a siliconizing solution for the purpose of encapsulation?
Did she know Al-Timimi who shared a suite with the inventors of a process to use silica in the culture medium?
Was Al-Timimi one of the cell members referenced in the correspondence on her thumb drive when she was captured in July 2008?
As the result of a secret undisclosed program, was this all known by the White House and Vice President Cheney’s Office but kept from Amerithrax?
Why is Dr. Bannan privately mentioned by a reporter to me in connection to the Aafia Siddiqui case?
Does Dr. Bannan multi-task and consult with intelligence agencies on bioweapons when he is not supporting hanging Amerithrax on the dead guy who — yikes! — used fake screen names on the internet and liked pictures of blindfolded sorority coeds?
And did Aafia have potential access to the collection of anthrax strains at Brandeis and did that long-held collection include Ames? On March 11, 2002, the Brandeis General Counsel sent an email advising that the federal authorities had subpoenaed records in connection with the investigation of the anthrax crimes.
In November 2001, the Hazmat Team and the State Department of Health was called after three researchers were doing research with anthrax and Administration officials were concerned there might be contamination. The scientists were confident all scientific protocols had been followed but Hazmat was called nonetheless. The research had been done after the anthrax mailings seeking means to detect anthrax spores. The anthrax used had been at Brandeis a long time, acquired at a time before federal regulations in 1997 required that transfers be recorded — and before Ivins’ flask 1029 was created. The lab was in the Kalman Building, part of the complex of buildings adjoining the Volen Center. Brandeis researchers Daniel Perlman and Inga Mahler had “decided to focus on developing a solid growth medium for cultivating B. anthracis that might be usable in the field with a minimum of equipment. They further developed the growth medium for use at room temperature thereby obviating the need for equipment such as incubators for sustaining an elevated temperature.” The pair obtained a patent issued March 2004 titled “Selective growth medium for Bacillus anthracis and methods of use.”
Dr. Perlman has been innovative on a wide range of consumer products to include yogurt involving silicon dioxide microparticulates in its processing. Ayman Zawahiri’s program was code-named yogurt or curdled milk — Zabadi in Arabic. Brandeis life sciences PhD was tasked with researching germ warfare. The FBI’s Dr. Bannan needs to put aside his visions of Bruce Ivins’ panty raids and roll up his sleeves regarding the hypothesis of silicon dioxide microparticulates in processing as they relate to other persons of interest.
Dr. Perlman has been innovative on a wide range of consumer products to include yogurt involving silicon dioxide microparticulates in its processing; Dr. Mahler had published on the subject of gram positive and gram negative bacteria (the subject underlying the patent) in the Journal of Bacteriology in 1989. Dr. Mahler years ago advised me that the strain of Bacillus anthracis they used in December 2001 was ordered by her group at Brandeis almost 40 years ago. It came from the American Type Culture Collection and was kept viable, together with other stock strains. She explains that before 9/11 you could simply obtain the organism from culture collections or colleagues. Their offices are in Abelson-Bass-Yalem, adjoining the Volen Center where Aafia’s lab was located. The strain used, Dr. Mahler advises (referred to in the paper as MC 607) — MC stands for Rosenstiel Center — was Vollum, not Ames. Vollum is a strain that like Ames is used to challenge vaccines. It is less lethal but was used by the US in the 1950s in making anthrax weapons. Dr. Mahler reports she knew of no Ames on campus. Dr. Perlman did not respond to an email query. The anthrax was autoclaved, or inactivated in a pressure cooker, before the inspectors arrived at the scene.
Aafia obtained her PhD from Brandeis in 2001, having graduated from MIT with a degree in biology in 1994. The Visual Lab at which Aafia worked had rules: “No Hitting, No Punching, No Pushing, No Grabbing, No Biting.” Judging from its internet page, the lab seems to have been a pleasant place to work. The operating manual instructed that if you don’t know “ask.” The lab’s work under Robert Sekuler, mainly funded by a grant from the NIH, related to how we remember, forget, or misremember things. Aafia’s 2001 183-page thesis “Separating the components of imitation,” which concerns visual learning and visual discrimination, was very far removed from questions like the Palestinian conflict or creating a fine powder using a mini-spraydryer.
In the first year of their Ph.D. program, students do 4 nine-week rotations in different laboratories of their choosing. First-year course work includes a core class in principles of neuroscience, and intensive graduate level seminars that give students experience in reading original research literature and making oral presentations. Graduate research advisors are typically chosen at the end of the first year. So one question is: what different labs did Aafia work in during her first year? It is related to the question: what is the origin of the anthrax spraydrying documents on the laptop of the colleague of Aafia’s future husband al-Balucchi? She says that she for a time was tasked with researching germ weapons and worked as a lab technician at Karachi Institute of Technology (this apparently was while there was a $5 million BOLO out for her — good work guys in tracking down the scientists helping Al Qaeda).
“Aafia Siddiqui was here (Boston) in June 2001— when some press reports suggest she was in Liberia meeting with Atef — says the family’s attorney, Elaine Whitfield Sharp. “And I can prove it.” When her attorney proposed to the family that they obtain her credit card records by subpoena, the family vetoed the idea. Although it should have been easy to check, no members of a play group were brought forward to say that Aafia was in Boston in June. Although I may be mistaken, I believe counsel for the family succeeded at preventing Ismat, the mom, from having to testify before a grand jury in Boston on the grounds that she was too distraught over the disappearance of her daughter.
The District Court Judge seems to be bending over backwards in being fair. Aafia has received excellent legal representation but for reasons that are unclear seems not to be cooperating. She, according to some, thinks she may be repatriated to Pakistan if found to be incompetent. Of course, KSM has not cooperated and rejected legal assistance also.
And people should come to understand encapsulation which was suggested by Ken Alibek’s former assistant two doors down from Al-Timimi as perhaps indicated by the forensics.
As Dr. Nass’ webpage explains, Ellen Byrne, wife of Dr. Ivins’ former colleague, has created “several designs encapsulating aspects of this case. They can be purchased on T-shirts and coffee mugs.”
DXer said
Q: How many bureaucrats does it take to screw in a light bulb?
A: Two. One to assure everyone that everything possible is being done while the other screws the bulb into the water faucet.
DXer said
Bacillus anthracis and Bacillus subtilis spore surface properties and transport
Gang Chena, , Adam Driksb, , , Kamal Tawfiqa, , Michael Mallozzib, and Sandip Patila,
Abstract
Effective decontamination of environments contaminated by Bacillusspores remains a significant challenge since Bacillus spores are highly resistant to killing and could plausibly adhere to many non-biological as well as biological surfaces. Decontamination of Bacillus spores can be significantly improved if the chemical basis of spore adherence is understood. In this research, we investigated the surface adhesive properties of Bacillus subtilis and Bacillus anthracis spores. The spore thermodynamic properties obtained from contact angle measurements indicated that both species were monopolar with a preponderance of electron-donating potential. This was also the case for spores of both species missing their outer layers, due to mutation. Transport of wild type and mutant spores of these two species was further analyzed in silica sand under unsaturated water conditions. A two-region solute transport model was used to simulate the spore transport with the assumption that the spore retention occurred within the immobile region only. Bacillus spore adhesion to the porous media was related to the interactions between the spores and the porous media. Our data indicated that spore surface structures played important roles in spore surface properties, since mutant spores missing outer layers had different surface thermodynamic and transport properties as compared to wild type spores. The changes in surface thermodynamic properties were further evidenced by infrared spectroscopy analysis.
Article Outline
1. Introduction
2. Materials and methods
2.1. Bacteriological methods
2.2. Methods
2.2.1. Measurement of surface thermodynamic properties
2.2.2. Spore–medium interaction quantification
2.2.3. Column experiments
2.2.4. Transport modeling
3. Results and discussion
3.1. Spore surface properties
3.2. Spore transport
3.3. Spore retention in the system
3.4. Infrared spectroscopy analysis
4. Conclusion
Acknowledgements
References
1. Introduction
Bacterial spores are dormant, highly resistant cells that can endure almost any stress that nature has to offer and persist for extreme periods of time [1], [2], [3], [4], [5], [6], [7] and [8]. Spores are formed in response to starvation. Once nutrient becomes available, spores return almost immediately to vegetative growth via the process of germination [9], [10], [11] and [12]. Bacterial spores are of great importance for a wide variety of reasons. They are ubiquitous in nature, being found in almost every terrestrial and marine environment [6] and [13]. As a result they have major ecological impact. Spores are also widely employed in industry for the control of crop pathogens [14]. They are also a major human health concern, as a cause of hospital-associated and food-borne diseases [15] and [16]. For these and other reasons, bacterial spores have been a major topic of research since their first description over 130 years ago [17] and [18].
For decades, it has been well known that spores of the species Bacillus anthracis are highly effective biological weapons [19]. Recent attention to this threat has highlighted the need for improved technologies for spore decontamination. Current methods used to remove spores from surfaces are empirically determined and suboptimal, consequently they are usually harsh and difficult to employ efficiently in large areas [20]. Development of improved decontamination methods would very likely result from a better understanding of the forces mediating adhesion of spores to surfaces. This information would also improve our understanding of the interactions of spores with natural surfaces. For example, the ability of Bacillus thuringiensis spores to adhere to plant material may have significant impact on their roles in insect control [21].
Spores adhere to surfaces via their outermost layers. In some species, such as Bacillus subtilis, the surface of a structure called the coat, present in all bacterial spores, is the outermost layer [22] and [23]. In other species, such as Bacillus megaterium, Bacillus laterosporus and B. anthracis, the spore is encased in an additional structure called the exosporium, which is structurally and biochemically distinct from the coat [24], [25] and [26]. A large number of coat proteins, in B. subtilis, and exosporium proteins, in B. anthracis, have been identified, including proteins at the surfaces of each structure [5], [10], [27], [28], [29], [30], [31], [32], [33], [34], [35], [36] and [37]. Therefore, it is realistic, at the present time, to begin to identify the spore-surface proteins and structures responsible for spore surface properties, including adhesion.
In spite of its importance, the chemical basis of spore adhesion to surfaces is still poorly understood. At present, only a few studies have analyzed the chemical or physical properties of bacterial spore surfaces, and it is difficult to draw general conclusions (see, for example [38]). Adhesion of Bacillus spores to porous abiotic surfaces (such as soil and other sediment) is attributed to attractive interactions between spores and these porous media [39], [40], [41] and [42]. It is suspected that Bacillus spore adhesion to the porous medium surfaces in the subsurface is correlated with the spore and medium surface thermodynamic properties [43], [44], [45] and [46]. Consistent with this, spores with different surface thermodynamic properties have been demonstrated to have different adhesion kinetics and affinities for abiotic surfaces [44]. We hypothesize that the surface thermodynamic properties of the spore surface are an evolutionary adaptation facilitating productive interactions between the spore and its environment. In this view, the adhesive properties of a spore are as important as any other taxonomic characteristics, such as resistance to small molecules or the ability to germinate [7], [47] and [48].
This research was devoted to an experimental investigation of spore surface chemical properties, and the impact of spore surfaces on these properties. Using well-characterized strains of B. subtilis and B. anthracis, we measured spore surface thermodynamic properties and conducted column transport experiments in silica sand. We also analyzed mutant spores, missing various surface components, to address the impact of spore-surface proteins and structures on spore properties. Transport was simulated by convection-dispersion models with a kinetically controlled sink term to describe spore adhesion in the porous media. Difference of spore transport observations of wild type and mutant spores was explained in terms of the free energy of interactions between the spores and the media based on their independently determined spore and medium surface thermodynamic properties.
2. Materials and methods
2.1. Bacteriological methods
All strains are congenic with 34F2 Sterne strain of B. anthracis or strain PY79 of B. subtilis [49]. Bacteria were cultured, sporulated and strains constructed as described previously [30] and [50]. To build B. subtilis strain ADL2231 (cotG::erm cotB::cat::spec), we first transformed strain PY79 with DNA from strain ER203 to generate strain DM134 (cotG::erm) [51]. We then transformed strain DM134 with genomic DNA from strain DM97 (cotB::cat::spec). To build B. anthracis strain MGM76 (in which bas1140, the orthologue of B. subtilis cotO, is inactivated), we first built plasmid pMGM3.
To do this we used the polymerase chain reaction (PCR) to amplify an internal fragment of the cotO gene using primers OL822-(GGTACCTGGGAGGGACGAGTGTGAAGAATA) and OL823-(AAGCTTGGCGGCATAATGGCTACAATTCCA) with KOD polymerase (Novagen), and purified the 450 bp product using the QIAquick PCR Purification Kit (Qiagen). The purified product was then ligated to SmaI-cut pKS1 [52] and transformed into the INV110 strain of Escherichia coli (-dam dcm-). We then used plasmid pMGM3 to transform B. anthracis and selected for the insertion of pMGM3 into the chromosome as previously described [50] and [52], thereby generating strain MGM76 (cotOΩpMGM3 (kanR ermR)). Integration of pMGM3 into the cotO locus was confirmed by PCR. Extensive characterization of this strain will be presented in a future manuscript. For the present investigation, it is important to note that spores from strain MGM76 lack the exosporium, as determined by electron and immunofluorescence microscopy (performed as in [50]) and have only a modest defect in the coat, based on electron microscopy and SDS-PAGE analysis (data not shown).
Prior to analysis, spores were washed three times in double-distilled water and were heat-treated at 65 °C for 30 min to kill any viable vegetative cells. The spores were then centrifuged at 2500 RPM in a centrifuge (Damon/IEC Division, Needham Heights, MA) for 20 min. One aliquot of the centrifuged pellets was re-suspended in nano-pure de-ionized water at a concentration of 5 × 109 spores/ml and used as the injectant for the column transport experiments. Another aliquot was freeze-dried and used for infrared spectroscopy analysis. As discussed in the following sections, interactions between spores and the surrounding environment are water-mediated. Therefore, pure water surface properties were used for the interaction calculations and spores suspended in de-ionized water were used in the column experiments. Since the salt concentration for subsurface aquatic environments is usually very low, our results are likely to replicate natural conditions.
The porous medium used in this research was silica sand (8 mesh, 2.38 mm in diameter, Fisher Scientific, Pittsburg, PA). Silica sand was first rinsed with de-ionized water and then treated with sodium acetate, hydrogen peroxide, sodium dithionate and sodium citrate to remove organic matter. Silica sand was then extensively flushed with sterilized nano-pure de-ionized water until the electrical conductivity was less than 1 dS/m. Silica sand was sterilized at 121 °C and 1 atm for 20 min before use.
2.2. Methods
2.2.1. Measurement of surface thermodynamic properties
According to the traditional and extended Derjaguin–Landau–Verwey–Overbeek (DLVO) theory, Bacillus spore surfaces can be described by their surface thermodynamic parameters of van der Waals component of surface tension (γLW), electron-acceptor parameter (γ+) and electron-donor parameter (γ−) of Lewis acid/base component of surface tension, and surface potential (ψ) [53]. Surface thermodynamic properties of Bacillus spores were estimated by the contact angle measurement (Contact Angle Meter, Tantec, Schaumburg, IL) following the method described by Grasso et al. [54]. Specifically, Bacillus spores were vacuum filtered on silver metal membrane filters (0.45 μm, Osmonic, Inc., Livermore, CA) and air-dried for about 30 min until the moisture content was in the range of 25–30%. An apolar liquid, diiodomethane and two polar liquids, formamide and water were used for the contact angle measurement. Each measurement was repeated 30 times.
Surface thermodynamic properties of the medium, silica sand, were studied using the wicking method [55] and [56]. This method determined the contact angle by measuring the velocity of capillary rise through the porous medium based on the Washburn equation:
(1)h2=(RetγLcos β)(2μ)−1where h is the height (m) of capillary rise of the wicking liquid at time t (s); γL is the total surface tension of the wicking liquid (mJ/m2); μ is the viscosity of the measuring liquid (N s/m2) and Re is the average interstitial pore size of silica sand (m). The average interstitial pore size Re was estimated by using a liquid with low surface tension, such as methanol (γ = 22.5 mJ/m2) or hexane (γ = 18.4 mJ/m2). Methanol or hexane spreads over the solid surface during the wicking measurement, resulting in cos β = 1. Similarly as Bacillus spore contact angle measurements, diiodomethane, formamide and water were used as the measuring liquids.
Surface thermodynamic parameters of Bacillus spores and the porous medium of silica sand were estimated by the van Oss–Chaudhury–Good equation [57]:
Bacillus spore hydrodynamic radii were measured using a Malven Zetasizer (3000 Has, Malvern Instruments Ltd., Malvern, Worcs, UK) by suspending the spores in the sterilized buffer solution, which were determined to be 1.2 μm and 1.0 μm for B. subtilis and B. anthracis respectively. There was no obvious observed variation in spore size for the mutants.
***
2.2.2. Spore–medium interaction quantification
Assuming that Bacillus spores behave as inert particles and spore adhesion can be understood by a physicochemical approach, DLVO theory can be used in describing spore adsorption in porous media. Spore–medium interactions that should be considered include the Lifshitz–van der Waals, Lewis acid–base and electrostatic interactions, which can be calculated as:
(3)
(4)
(5)where , , and are the free energies of the Lifshitz–van der Waals, Lewis acid/base, and electrostatic interactions between the spores, 1 and the porous medium, 2 immersed in the water, 3 evaluated at the equilibrium distance, y0 of 1.57 × 10−10 (m); R is the spore radius (m); and 0 are the relative dielectric permittivity of water (78.55 for water at 25 °C) and permittivity under vacuum (8.854 × 10−12 C/V m) respectively; ψ01 and ψ02 are the potentials at the surfaces of the spores and the porous medium; and 1/κ is the Debye-Hückel length and also an estimation of the effective thickness of the electrical double layer [58]. ψ01 and ψ02 can be calculated based on the following equation:
(6)where ζ is the zeta-potential measured at the slipping plate; z is the distance from the spore or silica sand surface to the slipping plate, which is generally on the order of 5 Å [53]; and a is the radius of the spores or the silica sand.
2.2.3. Column experiments
Transport of the spores through the porous medium of silica sand was evaluated in column experiments (5.0-cm ID × 25.0-cm length) under steady-state flow conditions at effective water saturations of 0.35, a typical moisture content in the subsurface used in this work. The inflow was applied using a sprinkler from the top by the peristaltic pump at a flow rate of 3.5 ml/min. During the column experiments, matric potential inside the column was monitored using three tensiometers mounted evenly along the length of the column. The measured matric potentials were recorded using a Campbell Scientific CR-7X datalogger (Campbell Scientific, Inc.). Water content within the column was predicted by the van Genuchten equation in term of effective water saturation, Se [59] and [60],
e performed.
***
2.2.4. Transport modeling
Under unsaturated water conditions, spore transport can be described by the mobile–immobile two-region model [61]:
***
3. Results and discussion
3.1. Spore surface properties
The surface of B. subtilis spores is the outer layer of the protein coat. At least three coat proteins, CotB, CotC and CotG, likely contribute to spore surface properties [27], [28], [29] and [63]. The surface of B. anthracis spores, in contrast, is not the coat but the exosporium. A major constituent of the exosporium surface is the glycoprotein BclA [34] and [35]. At present, the only other well-characterized exosporium surface component is the glycoprotein BclB [36] and [37]. In spite of these differences, there were major similarities in the surface properties of spores of both species. Both of these spore surfaces were found to be monopolar, i.e., γ− was at least one order in magnitude greater than γ+. Also, both were negatively charged (negative zeta-potential values). There was no regularity in zeta-potential change with respect to changes in spore-surface proteins due to mutations in coat protein genes.
To analyze the effects of surface structures on B. subtilis spore surface properties, we analyzed spores of strain ADL2230 (cotB cotG) missing two major surface proteins [27] and [29], and strain PE250 (cotO), missing a larger set of outer coat layer proteins, including all of those at the surface [64]. While these spores were also monopolar and negatively charged, cotB cotG mutant spores had smaller γLW and γ− values and greater γ+ values than wild type spores, and cotO mutant spores had even smaller γ− values and greater γ+ values (Table 1). Accordingly, wild type spores have greater γLW and γ− values and smaller γ+ values. There was no regularity in the effects of mutation on zeta-potential change. Taken together, these data demonstrated that the chemical properties of the spore coat layers varied and, more importantly, at least two B. subtilis spore-surface proteins made significant contributions to the spore surface chemical properties.
***
For B. anthracis, we found that the wild type spores were monopolar and negatively charged (Table 1). As compared to B. subtilis spores, they were more negatively charged. To determine the roles of spore surface structures, we analyzed a bclA mutant, missing the immunodominant exosporium surface protein [65]. To determine the role of the exosporium itself, we built and analyzed a cotO mutant. We found that about 70% of cotO mutant spores lacked the exosporia, as determined by immunofluorescence microscopic analysis using anti-BclA monoclonal antibodies, and electron microscopy (data not shown). However, these spores possessed at least some if not most of the coat. Similarly to the case of B. subtilis, we found that these B. anthracis mutants were still monopolar and negatively charged, and less so than in wild type. Also in B. anthracis, wild type spores have greater γLW and γ− values and smaller γ+ values. bclA mutant spores had the smallest γLW and γ− values and greatest γ+ values, and cotO mutant spores had intermediate values (Table 1).
The free energy of the van der Waals interactions between the spore and silica sand was negative for all strains, indicating that van der Waals interactions contributed to spore adhesion to silica sand in all cases (Table 2). However, the free energy of both Lewis/acid base and electrostatic interactions was positive, meaning that these two interactions would prevent spores from attachment to the silica sand. The net effect as reflected by the total interaction free energy of the three forces demonstrated that the spores would be repelled away from the silica sand surface. Spore adhesion to the liquid–gas interface, evaluated using the total free energy of interactions between the spores and the liquid–gas interface indicated that the spores would be able to attach to the liquid–gas interface. Based on above analysis, it can be concluded that the spores would not attach to the silica sand surface, instead, they would attach to the liquid–air interface.
***
We found that the adhesion of spores to solid surfaces was similar to the adhesion of other bacteria to these surfaces. Therefore, we followed traditional DLVO theory in which the van der Waals and electrostatic repulsive interactions between bacteria and solid surfaces displays power-law and exponential functions with respect to separation distance [66], [67] and [68]. Consequently, a secondary energy minimum exists, where spores engage in attractive interactions with the porous medium. These attractive interactions at the secondary minimum aid spore accumulation at solid surfaces. At this stage, the electrostatic force barrier prevents spores from getting closer to the medium surfaces. However, with the aid of hydrodynamic forces, spores may overcome the repulsive barrier and end up at the equilibrium distance from the medium surfaces.
Once spores overcome the barrier and get close to the medium surfaces, their interactions can be further evaluated at the equilibrium distance [69] and [70]. As shown in Table 2, spores with altered surfaces (due to various mutations) had less repulsive interactions with the medium surfaces and less attractive interactions with the liquid–gas interface at the equilibrium distance. Consequently, these spores were less likely to be retained in the system.
3.2. Spore transport
The porous medium parameters were estimated by simulating the tracer breakthrough curves using the mobile-immobile two-region model with β = 0 and μ = 0. During the simulation, the velocity was fixed at 0.35 cm/min and the initial Dm was set as 7.89 cm2/min. After the simulation, D was determined to be 3.35 cm2/min, which was then used for all the simulations of spore transport.
Under unsaturated water conditions, spores were retained in the media during transport for both wild type and mutant spores. All the spore breakthrough curves displayed a narrow self-sharpening front, which became broader and diffuser at the elution limb (Fig. 1). Also, the breakthrough fronts corresponded to the arrival of the infiltration at the outlet of the column. The long-lasting tails of the breakthrough curves indicated kinetic-controlled spore retention in the column. In both species, the mutant spores had more retention as manifested by their smaller peak-valued breakthrough curves as compared to wild type spores (Fig. 1). The enhancement of spore retention is more pronounced for B. subtilis mutants than those of B. anthracis. Interestingly, less retention of the spores was observed for mutants lacking relatively few outer structures (cotB cotG in B. subtilis and bclA in B. anthracis) than in mutants lacking more outer structures (cotO in either species). Based on these data, it is reasonable to speculate that in natural environments such as soil and bodies of water, where spores can move between a solid surface and water, spores will be in water a significant fraction of the time, if not most of the time. Our data further suggested that the tendency for spores to reside in the water fraction was impeded by the outermost spore layers.
***
3.3. Spore retention in the system
To investigate the mechanisms of spore retention within the pore system, the interactions between the spores and silica sand and the interactions between the spores and the liquid–gas interface were examined. At the equilibrium distance, Lifshitz-van der Waals and Lewis acid/base interactions dominated over electrostatic interactions (induced by negatively charged spore and medium surfaces), and were the driving forces for spore adhesion since the electrostatic forces were three orders in magnitude smaller than the others. Since the net interactions of the spores with silica sand were repulsive, the spores were repelled from silica sand during transport within the column. On the other hand, the net interactions between the spores and the liquid–gas interface were negative, indicating that the spores would be able to attach to the liquid–gas interface. A likely consequence of the fact that, in nature, liquid–gas interfaces are often in motion, is that spores should accumulate at locations where the bulk liquid passes through a pore (which is a solid–liquid–gas three-phase interface) that is close to or smaller than the size of a spore (Fig. 2).
Fig. 2. Spore interactions with silica sand and the liquid–gas interface.
Retention of spores at small-diameter pore throats would be favored by low repulsive interactions between the spores and silica sand. To determine whether the repulsive forces were consistent with this view, the spore deposition coefficient was related to the interaction free energy between the spores and silica sand. Greater spore retention coincided with smaller (spore-silica sand) values, consistent with relatively low repulsive forces. This trend was evidenced in Fig. 3.
***
4. Conclusion
Adhesion of Bacillus spores to abiotic surfaces is attributed to attractive interactions between the spores and the porous media. For this research, surface thermodynamic properties of wild type and mutant Bacillus spores were estimated based on contact angle measurements and related to their transport in silica sand. Bacillus spore adhesion to the porous media was found to correlate with the interactions between the spores and the pore water system, which were determined by their surface thermodynamic properties. A major conclusion from our work was that, under our conditions, both B. subtilis and B. anthracis spores were monopolar and negatively charged, in spite of their divergent surface composition and architecture and, apparently, natural ecology. We speculate that significant evolutionary pressures direct these spore surfaces towards similar chemical properties because, despite their differences in lifestyle, B. subtilis and B. anthracis spores benefit from relatively similar adhesive characteristics. This may point towards important similarities in the survival in the otherwise differing niches inhabited by these organisms.
In both species, the spore surface thermodynamic properties changed in largely similar ways when increasingly more of the spore surface was missing due to mutations. In general, adhesion was increased in the mutants, suggesting that the interior layers of the coat are, for the most part, relatively adhesive. This is consistent with prior work indicating that bclA affects adhesion of the Ames strain of B. anthracis to epithelial tissue [65]. Possibly, spore surface layers have adapted to reduce the adhesive properties of spores composed of proteins that are, for the most part, rather sticky.
What is the chemical basis of the effect of spore surface proteins on adhesion? This is a complex question, in light of the similarities in adhesion but complete lack of similarities in the surface proteins themselves. To address this, we analyzed spore surfaces using infrared spectroscopy, and found specific chemical groups that varied on the surface in a manner consistent with changes in surface thermodynamic properties. We concluded, therefore, that the types and abundance of these functional groups on the spore surface had a significant impact on adhesion and transport properties.
Acknowledgements
The work was supported by the National Research Initiative of the USDA Cooperative State Research, Education and Extension Service, Grant No. 2007-35102-18111 to Florida A&M University.References
DXer said
Copyright © 2009 Elsevier Ltd All rights reserved.
Review
The Bacillus anthracis spore
Adam Driksa,
aDepartment of Microbiology and Immunology, Loyola University Medical Center, 2160 South First Avenue, Maywood, IL 60153, USA
Abstract
In response to starvation, Bacillus anthracis can form a specialized cell type called the spore, which is the infectious particle for the disease anthrax. The spore is largely metabolically inactive and can resist a wide range of stresses found in nature. In spite of its dormancy, the spore can sense the presence of nutrient and rapidly return to vegetative growth. These properties help the spore to persist for long periods of time in the environment, survive host defenses after entering the body, and cause disease when the correct location in the host is reached. The anatomy of the spore is unique among bacteria, being comprised of a series of specialized concentric shells, each of which provides specific critical functions. Surrounding the spore core (which houses the chromosome) is a peptidoglycan layer important for spore dormancy, a protein shell that resists a variety of toxic molecules, and finally an exterior protein and glycoprotein layer that, among other functions, mediates interactions with surfaces, including those encountered by the spore within the host. Detailed molecular analysis of these shells has shed considerable light on how each layer determines specific spore properties. Future work, especially on the outermost spore layer, is likely to advance therapeutics, methods for spore decontamination and other critical biodefense technologies.
Article Outline
1. Introduction
2. Building an alternate cell type: sporulation
3. The decision to sporulate
4. Spore anatomy
5. The return to growth: germination
6. Roles of the outer structures in pathogenesis
7. Future directions
References
1. Introduction
The ability to form a dormant, resistant spore allows Bacilli to populate a diverse range of environments, including soil, bodies of water and animal hosts ([Fritze, 2004] and [Nicholson, 2002]). In the case of Bacillus anthracis, the dormant spore is the infectious particle for the disease anthrax ([Inglesby et al., 1999] and [Inglesby et al., 2002]). Bacterial spores are ideal infectious agents; they can remain dormant in the environment until the opportunity for infection arises, and survive host defenses after infection. Spores leave the dormant state, in a process called germination, once they sense that conditions are suitable for proliferation. Importantly, germination is required for the expression of toxin and capsule, critical virulence factors for anthrax (see chapter by T. Koehler). Therefore, in B. anthracis, spore formation and germination are major virulence factors. It is the importance of this specialized life style to the etiology of anthrax that led Koch to describe spore formation in B. anthracis almost 140 years ago (Koch, 1876).
2. Building an alternate cell type: sporulation
Spore formation (called sporulation) initiates when nutrient is limited. This fact, along with the abilities of the spore to remain dormant for extended periods and to withstand a variety of stresses ([Aronson and Fitz-James, 1976] and [Driks and Setlow, 2000]) lead to the view that a shared purpose of all bacterial spores is to survive starvation conditions, in whatever environment the spore finds itself, and for as long as is needed to await the return of food. In some species, however, such as B. anthracis, the resistance and dormancy properties of the spore likely also contribute to survival by aiding dissemination (see chapter by M. Hugh-Jones). Other pathogenic spore formers (such as Bacillus thuringiensis and Clostridium perfringens ([Aronson, 2002] and [Mead et al., 1999])) may also rely on spores for dissemination. An additional clue that the ecological role of the spore may be more complex than simply its superior resistance comes from several studies suggesting that vegetative Bacilli (including Bacillus cereus, Bacillus subtilis and, possibly B. anthracis) are present in soil (presumably, along with spores) ([Graham and Istock, 1979], [Mehta et al., 2006] and [Vilain et al., 2006]). If these data can be interpreted to suggest that Bacilli survive in the soil without forming spores, than they raise the possibility that spores contribute to success in the soil environment in as yet unknown ways. The possibility that Bacilli react to stress by forming several cell types simultaneously, rather than a population solely composed of spores, is supported by the discovery that B. subtilis can form complex communities (known as fruiting bodies) composed of cells in a variety of developmental states, including spores and non-sporulating cells, organized in three dimensions (Branda et al., 2001). Therefore, while the ability to survive starvation in essentially any ecological context is a powerful general solution to the ubiquitous problem of extreme stress, sporulation may also contribute to survival as a member of a complex community that does not necessarily experience stresses that kill all other cell types.
3. The decision to sporulate
Sporulation is a complex developmental process that takes place over the course of 8 h, in a series of carefully coordinated stages that have been deeply analyzed in B. subtilis and which are substantially the same in B. anthracis ([Errington, 2003], [Giorno et al., 2007], [Losick et al., 1986], [Onyenwoke et al., 2004], [Piggot and Losick, 2002], [Piggot and Coote, 1976] and [Steichen et al., 2007]). The specific chemical signals that trigger sporulation remain unknown. However, it is known that the decision to sporulate is computed by an elaborate signal transduction network that integrates a variety of signals, including not only the levels of nutrient molecules but also the state of the cell cycle and secreted factors ([Grossman, 1995] and [Hoch, 1993]). The mechanistic details of this system have been studied deeply only in B. subtilis but related signal transduction networks are likely to be present in most if not all Bacilli (Onyenwoke et al., 2004). In particular, homologues of many of the genes encoding the B. subtilis network are present in B. anthracis (Brunsing et al., 2005).
Given the potentially complex and varying roles for spores in nature, already discussed, it is likely that as bacilli populate novel niches, the signal transduction network that initiates sporulation evolves, allowing each species to control the onset of sporulation in a manner most appropriate to its niche. An interesting example of this was characterized by Perego and her colleagues, who showed that the sporulation-initiation signal transduction network in B. anthracis differs significantly from that of B. subtilis, and that these differences are likely to be critical to ensuring that B. anthracis does not sporulate in the blood of the host, an event that would likely dramatically reduce virulence (see (Perego and Hoch, 2008) and references therein). This work serves as an important example of the importance of model systems; these insights into sporulation initiation in B. anthracis would not have been possible without the prior deep mechanistic understanding of the cognate system in B. subtilis (Hoch, 1993).
4. Spore anatomy
The spore is essentially a series of concentric shells (Fig. 1). The most interior compartment, the core, houses the spore chromosome, which is tightly complexed with proteins called the small acid-soluble proteins (or SASPs) ([Driks and Setlow, 2000] and [Setlow, 2007]). The interactions between the DNA and the SASPs, and the high levels in the core of calcium dipicolinic acid and other ions, provide considerable protection against multiple stresses including heat and UV radiation. Also critical to spore resistance is a membrane surrounding the core and, surrounding that, a layer of peptidoglycan called the cortex. Among other functions, the membrane and cortex help keep the core relatively dry (Setlow, 2003).
Surrounding the cortex is a multilayered protein shell called the coat ([Kornberg et al., 1968] and [Warth et al., 1963]). By thin-section electron microscopy, the B. anthracis coat appears as a thin, darkly staining layer (in other species, the coat can be thicker, and more morphologically complex) (Driks, 2002b). The coat surface is not that of a smooth sphere; rather, it has ridges and valleys (readily detected by atomic force microscopy), which appear as folds in cross-section (when visualized by transmission electron microscopy) ([Chada et al., 2003], [Driks, 1999], [Plomp et al., 2004], [Plomp et al., 2005] and [Warth et al., 1963]). The coat has a number of roles. It prevents the entry of large degradative molecules as well as the toxic activities of small reactive molecules (such as glutaraldehyde) and predation by other microbes ([Aronson and Fitz-James, 1976], [Driks, 1999], [Henriques and Moran, 2007], [Klobutcher et al., 2006], [Laaberki and Dworkin, 2008] and [Setlow, 2006]). Interestingly, the ridges can unfold ([Chada et al., 2003], [Driks, 2003], [Plomp et al., 2004], [Plomp et al., 2005] and [Westphal et al., 2003]). This flexibility allows the coat to accommodate the increase in core volume that accompanies germination (see below), when water enters the spore (Santo and Doi, 1974). Taken together, the protective functions of these structures allow bacterial spores to remain dormant for many years and, potentially, geological periods of time ([Nicholson, 2003] and [Vreeland et al., 2000]).
The outermost structure of the B. anthracis spore is a protein shell called the exosporium. The exosporium is present in a number of species (including Brevibacillus laterosporus, Bacillus megaterium, Bacillus naganoensis, Bacillus neidei, Bacillus odysseyi, Bacillus vedderi and the all members of the B. cereus-group ([Driks, Unpublished observations], [Hannay, 1957], [La Duc et al., 2004] and [Vary, 1994])). Species lacking the exosporium include Bacillus clausii, Bacillus licheniformis, Bacillus sonorensis and B. subtilis ([Driks, Unpublished observations] and [Warth et al., 1963]). In most species, the exosporium is a contiguous shell surrounding the coat and separated from it by a gap called the interspace, whose contents is still unknown. The proteins comprising the exosporium surface have received considerable attention in recent years, as these molecules are strong candidates for vaccines and ligands for spore detection ([Fox et al., 2003] and [Tournier et al., 2009]). These molecules can also be expected to have important roles in interactions with the environment (see below). Two exosporium-surface proteins, BclA and BclB, have been identified so far ([Sylvestre et al., 2002], [Thompson et al., 2007] and [Thompson and Stewart, 2008]). BclA, a collagen-like glycoprotein, is the best characterized of the two ([Boydston et al., 2005], [Giorno et al., 2009], [Steichen et al., 2003], [Sylvestre et al., 2002] and [Sylvestre et al., 2003]). The C terminal domain of BclA, and anthrose, a polysaccharide residue attached to BclA, contain the immunodominant spore epitopes ([Mehta et al., 2006] and [Steichen et al., 2003]).
5. The return to growth: germination
The process by which spores can leave the dormant state is referred to as germination. In B. anthracis, germination is triggered by amino acids, ribonucleosides and/or peptidoglycan fragments (collectively known as germinants), whose presence is detected by a set of receptors in the spore inner membrane ([Clements and Moir, 1998], [Fisher and Hanna, 2005], [Hornstra et al., 2005], [Hudson et al., 2001], [Ireland and Hanna, 2002], [Paidhungat and Setlow, 1999], [Setlow, 2003] and [Weiner et al., 2003]). Receptor binding leads to a cascade of events including the influx of water into the spore, swelling of the spore core, and dismantling of the cortex and coat ([Foster and Johnstone, 1990], [Moir et al., 2002], [Moir, 2006] and [Santo et al., 1973]). These events are followed by the resumption of metabolic activity and cell growth, collectively known as outgrowth. In B. anthracis, the trigger for germination is likely to be more complex than just the presence of nutrient-rich conditions, since successful pathogenesis appears to require that germination is restricted to specific locations in the host where bacterial survival does not depend on the spore ([Dixon et al., 1999] and [Mock and Fouet, 2001]). Presumably, in each Bacillus species, the germinant-sensing machinery has adapted to the specific challenges of the local niche, as discussed above in the context of sporulation. Another interesting example of a specialized germinant-sensing system is that of Clostridium difficile, a major cause of human gastrointestinal disease (Voth and Ballard, 2005 D.E. Voth and J.D. Ballard, Clostridium difficile toxins: mechanism of action and role in disease, Clin. Microbiol. Rev. 18 (2005), pp. 247–263. Full Text via CrossRef | View Record in Scopus | Cited By in Scopus (130)Voth and Ballard, 2005). C. difficile germinates in the gut, very likely in response to the bile salts, which act in concert with more traditional germinants such as glycine (Sorg and Sonenshein, 2008). Presumably, bile salts indicate to the spore that the environment is favorable for initiating infection. The examples of B. anthracis and C. difficile underscore an important point: to properly analyze the conditions for germination (or sporulation) of a given Bacillus species, we need significant knowledge about its natural ecology.
Interestingly, B. anthracis spores harbor alanine racemase, an enzyme that can convert the l-form of alanine, that stimulates germination, into the d-form, which inhibits germination ([Anmuth et al., 1956], [Chesnokova et al., 2009], [Fey et al., 1964] and [Weiner et al., 2003]). Alanine racemase is located on the exosporium (Steichen et al., 2007). Therefore, alanine racemase can convert alanine to a form that cannot stimulate germination before the amino acid reaches the germinant receptors within the spore. Reducing germination in this manner lowers the dose of spores needed to cause disease, suggesting that alanine racemase facilitates infection (McKevitt et al., 2007). The control of germination through alanine racemase also has a clear effect on spore stability during sporulation, since spores lacking alanine germinate before spore maturation is complete (Chesnokova et al., 2009). It is not clear how other Bacillus species prevent premature germination (or whether they even need a specific mechanism to do so), but it is possible that at least some species without exosporia also use alanine racemase, as alanine racemase activity is likely to be present in B. subtilis, which lacks an exosporium ([Kanda-Nambu et al., 2000], [Reusch et al., 1982] and [Yasuda et al., 1993]).
6. Roles of the outer structures in pathogenesis
The interior structures of the spore, the core and cortex, are largely similar among the species (Driks and Setlow, 2000). In contrast, the outer structures, the coat and, when present, the exosporium, show significant morphological variation. Spores of some species even possess more ornate outer structures including pilus-like fibers and ribbons ([Driks, 2007], [Hachisuka et al., 1966], [Hachisuka and Kuno, 1976], [Walker et al., 2007] and [Yolton et al., 1968]). Because the coat and exosporium vary so significantly, it is reasonable to investigate whether, in the case of B. anthracis, these structures contribute to the distinctive features of the species, especially pathogenesis.
It is very likely that the B. anthracis coat, like that of B. subtilis and B. cereus, plays important roles in spore resistance, thereby facilitating survival in the host ([Bailey-Smith et al., 2005], [Driks, 2002a], [Giorno et al., 2007], [Henriques and Moran, 2007] and [Kim et al., 2004]). However, it remains unclear whether any of the protective roles of the B. anthracis coat are adaptations specifically to host defenses. That is, the features of the coat that protect the spore against stresses in the host may be largely the same as those that protect in the environment. Future analyses of the roles of those coat proteins found in B. anthracis but not B. subtilis may help resolve this question ([Driks, 2002b], [Giorno et al., 2007] and [Kim et al., 2004]).
The B. anthracis exosporium can be assumed to play a role in interactions with the host, if for no other reason than that it forms the spore surface. This view is supported by experiments showing that the major exosporium-surface protein, BclA, influences spore adherence to macrophages and the cell surface integrin CD11b/CD18 ([Bozue et al., 2007] and [Oliva et al., 2008]). Interestingly, neither BclA (nor the exosporium) is required for disease when significant numbers of spores are used to infect animal models ([Bozue et al., 2007], [Brahmbhatt et al., 2007b], [Giorno et al., 2007], [Giorno et al., 2009] and [Sylvestre et al., 2002]). Nonetheless, in nature, where the infectious dose is likely to be lower than in the laboratory and where infections are more likely to be cutaneous or gastrointestinal, interactions mediated by BclA or other exosporium molecules may be much more important. It is also plausible that the exosporium plays roles outside of the host. For example, in the environment, the exosporium could facilitate adherence to soil particles or plant surfaces. These possibilities are notable in light of the presence of the exosporium in diverse Bacilli ([Aronson and Fitz-James, 1976] and [Holt and Leadbetter, 1969]).
7. Future directions
B. anthracis remains among the most likely of the known biothreat agents to be used as a weapon for a variety of reasons, including the ease of production, stability of the infectious (spore) form, and the existence of individuals with experience in its use as weapon (Smithson, 2001). Research on the spore can play an important part in reducing this threat, by contributing to the development of therapeutics as well as improved decontamination. For example, studies of spore composition could reveal novel vaccine antigens ([Brahmbhatt et al., 2007a], [Cote et al., 2008], [Cybulski et al., 2008], [Gauthier et al., 2009] and [Tournier et al., 2009]). Analysis of the composition of the spore surface, in particular, may improve our understanding of spore adherence and, therefore, facilitate decontamination. In particular, if spores could be reliably removed from surfaces, then they could be killed off-site, permitting the use of harsh methods that are inappropriate in human habitations or other ecologically valuable environments. Beyond the task of killing spores, highly efficient spore removal methods would facilitate efforts to measure the effectiveness of clean-up operations (Canter, 2005). Undoubtedly, continued basic studies will reveal entirely novel approaches to improved therapeutics, decontamination strategies, and other critical biodefense technologies.
DXer said
Political advocacy
Arizona is talking about closing additional state parks. Instead, stupid pork barrel research projects founded on revolving door government practices should be zeroed out. For example, in the biodefense area, proliferation just leads to greater risk. It was obscene that Bioport was allowed to give Admiral Crowe 10+ percent and his defense was that he didn’t have to do anything for the gift. The Center for Science in Public Interest has issued a report showing the skew in NAS appointments favors corporate and monied interests.
True crime analysis
Bruce Ivins gave virulent Ames to a scientist who associated regularly with members of the Egyptian Islamic Jihad and garnered $80 million in investment without a product while having the decontamination agent tested in the cleanup of the Capitol and pitching hand cream to postal workers. When one former EIJ member called him about patents prior to 911, he said it’s all in the marketing.
Conclusion
See how political analysis can be separated from true crime analysis?
For Ike to cut-and-paste arguments like “the FBI Director is bizarre” because he didn’t call back agents from retirement goes to show that outside commentators are far more clueless than the FBI ever was.
DXer said
Advertisement –
DXer said
DXer said
On December 7, 2001, Supervisory Special Agent Jennifer Gant of the Washington Field Office wrote a memo to the Washington Field Office and Amerithrax colleagues objecting to information sharing. The memo objected to a memo written by Agent Roth about entering Amerithrax leads into a central database and classifying the priority of leads.
She then was at the Hatfill search. Both were lead agents from the beginning throughout the Hatfill Theory.
Steven Hatfill – Quotes – UPI.com
This was told to my girlfriend by FBI agents Jennifer Gant and Pamela Lane. …
http://www.upi.com/topic/Steven_Hatfill/quotes/
So Ike’s suggestion that such players were part of a new team replacing those exploring a financial/pharma motive is not supported by anything he has cited.
Ike argues that Director Mueller’s decision not to call back retired agents into service when it is in fact just a management call. The decision is not at all “bizarre” and Ike’s argument in this regard illustrates that his argument is thin on factual support and infused with unrestrained political zeal. Being a political activist myself on matters where it is appropriate (politics has no proper place in true crime or intelligence analysis), I view it as poor advocacy to attack the NAS and FBI Director on unsupported grounds. Calling the FBI Director “bizarre” because according to some newspaper article he chose not to re-hire some retired agents in contact with a newspaper reporter is pretty weak support for any argument germane to the anthrax mailings. Even where political advocacy is appropriate, a social activist committed to social change should marshall factual support for claims and take care in not alienating critical audiences without relevant and material factual support. By way of example, if you think some front group is funded by the tobacco industry and has a financial conflict of interest, then take steps to show it. By making the claim without support, and tarring anyone who works in academia, then you cannot expose such issues when they present themselves. Ike has never even evidenced awareness of a spore’s natural tendency to absorb silicon in the spore coat and has not addressed, as I recall, the recent article by the Japanese researchers in the Journal of Bacteriology and has not corresponded with its author. Why not? That’s the rough where the ball lies. Go keep your eye on the moving ball instead of just using the golf club to beat the dead horse the political activists rode in on.
As for Ike’s theory about a drug company like Bioport, Ike might more fruitfully spend his time on the correspondence showing Dr. Ivins close work, site visits and the like with Bioport. And then interview former Bioport employees. There are many people with personal knowledge who are not bound by gag orders and Ike should interview them. Key information can come from anywhere and such interviews should be encouraged whatever the theory of the interviewer.
I appreciate Ike’s hard work in transcribing the NAS presentations which shows that he too values a substance-based approach. And so now I mean only to urge Ike to go make some telephone calls and to cite factual support for his assertions rather than merely re-stating them after they are disputed..
Ike Solem said
The problem with the NAS Committee has to do with:
1) Conflicts of interest among the committee members, as many of them are from institutes that are actively seeking to expand their biowarfare/biodefense programs. If the anthrax letters were intended to increase the flow of government tax dollars to such initiatives, then you can see that there might be a conflict of interest there.
2) Failure to call key witnesses from AFIP and USAMRIID who analyzed the Daschle-Leahy letters, as well as failure to call witnesses involved in the “morphological genotyping” claims put forth by the FBI.
3) Failure to ask the necessary questions of the witnesses.
4) A serious lack of transparency. If the case is closed, why is the FBI still holding many scientists to non-disclosure agreements? Why is the NAS and FBI refusing to release documents to the public? If these are “top secret” documents, did all the committee members receive “top secret” security clearances? And what about it needs to be so secret?
What this probably means is that a Congressional investigation is required, perhaps into the conduct of the NAS committee itself as well as into the FBI’s mishandling of the case.
In this effort, rumors and innuendo should be ignored and the recovered evidence and analysis of that evidence should take center stage. We’ve seen what “indications and assumptions” have lead to in Iraq (which clearly, despite the endless claims, had no biowarfare capacity in 2001).
Clearly, this was an attack that relied on sophisticated biowarfare technology, technology that required containment, access to the Ames strain, as well as unique aerosol drying capabilities. The only two places in the U.S. known to have such capabilities are Dugway Utah and the Battelle Memorial Institutes “microaerobiology” facility in West Jefferson Ohio. That’s where the FBI should have focused their investigation, but they didn’t – after the first few months, the lead FBI team was dismissed, replaced by the Hatfill-focused team, and then replaced again (after that farce) by the Ivins-focused team.
That’s a complete farce, isn’t it? Why did the FBI Director engage in such bizarre behavior regarding the worst bioterror attack to ever take place on U.S. soil? Was it done simply to protect these institutions from public scrutiny – and to hide the fact that the U.S. government had been manufacturing bioweapons as part of the “biological threat assessment programs” – which would be a violation of the Biowarfare Convention agreements the U.S. government signed onto?
DXer said
Ike Solem said
January 16, 2010 at 6:40 pm
The problem with the NAS Committee has to do with:
“1) Conflicts of interest among the committee members, as many of them are from institutes that are actively seeking to expand their biowarfare/biodefense programs. If the anthrax letters were intended to increase the flow of government tax dollars to such initiatives, then you can see that there might be a conflict of interest there.”
So long as you don’t mean to suggest that any of them are in violation of the NAS “Conflict of Interest” regulations. Under a rule of law approach, that is the pertinent consideration. The NAS is in full compliance in regard to its “conflict of interest” regulations it would appear — given you point to no financial conflict of interest even though you claim there were such conflicts.
“2) Failure to call key witnesses from AFIP and USAMRIID who analyzed the Daschle-Leahy letters, as well as failure to call witnesses involved in the “morphological genotyping” claims put forth by the FBI.”
Is the NAS done hearing from witnesses? If not, the criticism is not valid.
“3) Failure to ask the necessary questions of the witnesses.”
You are free to submit a comment raising the issues in a public comment.
“4) A serious lack of transparency. If the case is closed, why is the FBI still holding many scientists to non-disclosure agreements?”
The case is not closed as has been made plain by the FBI spokesman.
“Why is the NAS and FBI refusing to release documents to the public?”
They will release them at the end of the study and you are not commmitted enough to press the issue through pro bono litigation as I suggested. Public activism often requires litigation when there is a failure to comply with the legal standard (in this case, FACA, which does not have an exemption permitting the delay until after NAS review).
“If these are “top secret” documents, did all the committee members receive “top secret” security clearances? And what about it needs to be so secret?”
There are some documents that are classified. Some panel members already have clearance. Jennifer A.L. Smith was hopeful they would be declassified and released. The woman in charge said that the issue of document production had not been worked out. The reality is that without leverage, there is little reason to think there will be meaningful document production. The FBI will give the NAS what it chooses to give, just as has occured under the FOIA production by USAMRIID (which is being vetted by the FBI). The documents that would establish Ivins’ alibi on particular dates and times were withheld all this time which was very wrong.
“What this probably means is that a Congressional investigation is required, perhaps into the conduct of the NAS committee itself as well as into the FBI’s mishandling of the case.”
The NAS has done nothing warranting being subject to Congressional investigation. And saying so merely causes the points being made on the forum to be dismissed by panel members reading it.
“In this effort, rumors and innuendo should be ignored and the recovered evidence and analysis of that evidence should take center stage. We’ve seen what “indications and assumptions” have lead to in Iraq (which clearly, despite the endless claims, had no biowarfare capacity in 2001).”
“Clearly, this was an attack that relied on sophisticated biowarfare technology, technology that required containment, access to the Ames strain, as well as unique aerosol drying capabilities.”
There is no expert that agrees that it requires unique aerosol drying capabilities. I would ask that you name one. The drying part is the easy part.
“The only two places in the U.S. known to have such capabilities are Dugway Utah and the Battelle Memorial Institutes “microaerobiology” facility in West Jefferson Ohio.”
To the contrary, there were many, many of BL-3 labs. There is absolutely no basis to your claim. You used to argue a BL-4 lab was necessary which was equally specious.
” That’s where the FBI should have focused their investigation, but they didn’t”
This is just totally uninformed. That’s where many of the 200 polygraphs originally took place. In 2007 the letter to Ivins described how they were focused on 47 at Battelle. This is just politically-minded bogus point, that was also made by Barry. There is no basis for the claim that Dugway and Battelle was not thoroughly considered.
” – after the first few months, the lead FBI team was dismissed, replaced by the Hatfill-focused team, and then replaced again (after that farce) by the Ivins-focused team.”
You would have to support this claim with specifics. I have read the depositions in the Hatfill matter that provide great detail about personnel and don’t see to what you are referring.
“That’s a complete farce, isn’t it?”
What’s a complete farce is your claim, contradicted by the evidence, that Battelle personnel were not thoroughly investigated. For example, see the NYT article on Perry Miksell.
“Why did the FBI Director engage in such bizarre behavior regarding the worst bioterror attack to ever take place on U.S. soil?”
I find FBI Director frustratingly uninformative but he certainly never acts bizarre. He’s just so well-spoken and that he always succeeds, even before Senators, not to say anything that would give information in a confidential criminal, national security investigation. He is an experienced prosecutor of the highest caliber and leadership ability.
“Was it done simply to protect these institutions from public scrutiny – and to hide the fact that the U.S. government had been manufacturing bioweapons as part of the “biological threat assessment programs” – which would be a violation of the Biowarfare Convention agreements the U.S. government signed onto?”
There is nothing that is known that points to violation of the treaty. Making small amounts of aerosolized Ames is widely understood to be consistent with treaty obligations. Small scale production is indicated by the anthrax mailings. Only your bad opinion of US biodefense and political beliefs causes you to rely on those beliefs rather than the evidence of means, motive, modus opportunity and modus operandi relating to Ayman Zawahiri’s plan to use anthrax against US targets in retaliation for the rendition and mistreatment of senior EIJ leaders under the “Leahy Law.” A more credible suggestion is that the government was careful not to be required to submit international involvement in the investigation, as I believe France urged.
Ike Solem said
Clearly, the FBI Director has acted bizarrely in this investigation! From not allowing retired FBI agents to come onboard after the attacks, to dismissing the first FBI investigative team on the Amerithrax case after their work pointed towards pharmaceutical interests and putting the Hatfill team in in their place, to harassing Hatfill to the point that he won a massive multimillion dollar settlement against the FBI, to then targeting Bruce Ivins and allowing Douglas Beecher at the FBI HMRU to publish some completely unsupported claims about the “lack of additives” – while placing a still-standing gag order on AFIP and USAMRIID researchers, to bringing onboard a Kentucky professor linked to Battelle (Vahid Majidi) as an “FBI scientist” out of the blue – and then there is the enlistment of Battelle to provide a “second opinion” in the first case.
Second, while Rumsfeld and his cohort did claim that biological threat assessment for “defensive purposes” was legal, apparently someone stockpiled that material, which is clearly not legal under either international treaty law or domestic laws. The FBI claim that the spores had not been treated with additives is clearly nonsensical based on common sense as well as a long train of evidence. Ivins just as clearly did not have access to such technology.
The NAS committee has also not publicized the minutes of their “closed meetings” – nor have they even bothered to present a list of witnesses that they intend to call on – all in all, I think the analogy to the Soviet cover-up of the Sverdlovsk incident (which relied on top scientists in the Soviet health ministries to carry the water to the U.S. National Academy of Sciences) is entirely appropriate.
Finally, their complete lack of questions about the wild discrepancy between the USAMRIID and AFIP findings and the Sandia Labs findings is clearly indicative of a failure to do their job.
Hence, there really does need to be a Congressional investigation into how this NAS committee was set up in the first place – did the FBI go to select scientists and ask them to join the committee and carry their water for them?
DXer said
“Ike Solem said
January 17, 2010 at 3:20 am
Clearly, the FBI Director has acted bizarrely in this investigation! From not allowing retired FBI agents to come onboard after the attacks, to dismissing the first FBI investigative team on the Amerithrax case after their work pointed towards pharmaceutical interests and putting the Hatfill team in in their place,”
I asked you for support for this factual assertion and rather than provide it, you just re-stated it — which has become the pattern. Who was on the first FBI investigative team that you claim was dismissed after their work pointed towards pharmaceutical interest. Please provide authority when asked rather than just re-posting the same unsupported claim. Doesn’t the internal memorandum by Jennifer Gant about the prioritization of individuals show that the Special Agent JG at the Hatfill search, for example, was playing a leading role in 2001 also? I spoke to the other agent named in the search by the Wash Po, PG, and she had been on the investigation since 2001, also. Right? What is the factual support for your claim given that the memo by Jennifer G. seems to contradict it.
” to harassing Hatfill to the point that he won a massive multimillion dollar settlement against the FBI”
The $5.8 million was paid due to leaks in violation of the Privacy Act. It was Daniel Seikaly who pled the Fifth Amendment in connection with those leaks. His daughter came to represent the other weapons suspect Ali Al-Timimi pro bono.
“to then targeting Bruce Ivins and allowing Douglas Beecher at the FBI HMRU to publish some completely unsupported claims about the “lack of additives””
You are referring two sentences that should have had factual support (which was difficult because the source related to work done in an confidential investigation and that work is not being explained in the Sandia powerpoints. Yet you don’t cite factual support even though there is no such restraint.
” – while placing a still-standing gag order on AFIP and USAMRIID researchers, to bringing onboard a Kentucky professor linked to Battelle (Vahid Majidi) as an “FBI scientist” out of the blue”
“Out of the blue?” Are you privy as to such personnel decisions? The investigation is still ongoing and so it is not surprising that the gag orders are still in effect. You mistakenly thought in your last posts that the investigation was closed. It’s not.
” – and then there is the enlistment of Battelle to provide a “second opinion” in the first case.”
Early on, it was difficult, of course, to navigate past potential conflicts of interest given the small community. This is an example of damned if they do, and damned if they don’t. Critics lampoon the FBI for proceeding slowly in Fall 2001 and Spring 2002 (see Spring 2002) press — a time when the FBI needed to continue to sort out conflicts of interest and meet technical challenges — and then fault them for turning to the contractor who runs the country’s biodefense labs.
“Second, while Rumsfeld and his cohort did claim that biological threat assessment for “defensive purposes” was legal, apparently someone stockpiled that material,”
Apparently someone stockpiled that material? I know of no expert who has argued that 10 grams would violate the treaty and there is no evidence that it was stockpiled as part of any US biodefense program.
“which is clearly not legal under either international treaty law or domestic laws. ”
Not even Milton L. has argued that 10 grams would violate the treaty. Moreover, the rough nature of the first batch suggests that it was made for the purpose of the mailiing and not stockpiled.
“The FBI claim that the spores had not been treated with additives is clearly nonsensical based on common sense as well as a long train of evidence. Ivins just as clearly did not have access to such technology.”
You have not begun to treat the issue of the Silicon Signature with the sophistication of someone like Dr. Popov and so you might as well find and quote his opinion because otherwise it is just asserting your conclusion without factual support. The consensus among experts is that it was not due to accidental lab contamination. As to whether it was “naturally occurring” now seems to be a matter of semantics.
But let’s get back to the gaps in your factual support. You’ve been asked to support your claim about change in FBI personnel.
The NAS committee has also not publicized the minutes of their “closed meetings” – nor have they even bothered to present a list of witnesses that they intend to call on – all in all, I think the analogy to the Soviet cover-up of the Sverdlovsk incident (which relied on top scientists in the Soviet health ministries to carry the water to the U.S. National Academy of Sciences) is entirely appropriate.
Finally, their complete lack of questions about the wild discrepancy between the USAMRIID and AFIP findings and the Sandia Labs findings is clearly indicative of a failure to do their job.
Hence, there really does need to be a Congressional investigation into how this NAS committee was set up in the first place – did the FBI go to select scientists and ask them to join the committee and carry their water for them?
DXer said
Dr. Spertzel has opined that there are four additional letters that were recovered. Consider the person in the pouch and mail processing unit at the State Department, David Hose, who had inhalational anthrax (but survived).
Was that really due to cross-contamination from a misdirected Leahy letter?
Consider the anthrax found on the slitter at the White House at the same time. How many spores were found on the slitter?
If there is such hold-back, it seems like a fine idea for a variety of reasons. But it would make the number of plates that Dr. Ivins had to use, if he used plates, that much greater. Thus, it is worth knowing whether it is true whether there were 4 additional letters recovered. (I, for one, would be both surprised and fascinated).
White House Mail Machine Has Anthrax
By Sandra Sobieraj
Associated Press Writer
Tuesday, Oct. 23, 2001; 8:11 p.m. EDT
WASHINGTON –– President Bush said confidently Tuesday that “I don’t have anthrax” after biohazard testing at the White House and the discovery of anthrax on a mail-opening machine at a screening facility six miles away.
All White House mail – more than 40,000 letters a week – is examined at military facilities across the Potomac River.
“Let me put it this way,” Bush said. “I’m confident that when I come to work tomorrow, I’ll be safe.”
Asked if he was tested for the germ that has killed three people already this month, or if he was taking precautionary antibiotics, Bush replied simply: “I don’t have anthrax.”
At least some White House personnel were given Cipro six weeks ago. White House officials won’t discuss who might be receiving the anthrax-treating antibiotic now.
On the night of the Sept. 11 attacks, the White House Medical Office dispensed Cipro to staff accompanying Vice President Dick Cheney as he was secreted off to the safety of Camp David, and told them it was “a precaution,” according to one person directly involved.
At that time, nobody could guess the dimensions of the terrorists’ plot.
Now, Bush said on Tuesday, “There’s no question that the evil-doers are continuing to try to harm America and Americans.”
The president spoke in an afternoon Cabinet Room meeting with members of Congress, minutes after his press secretary announced that a “small concentration” of anthrax spores were found on the slitter machine that opens White House mail at a Secret Service-controlled facility on property shared by the Anacostia Naval Station and Bolling Air Force Base.
Between three and eight workers on loan from the U.S. Postal Service had access to that contaminated machine where a trace amount – anywhere from 20 to 500 spores – of anthrax was found, a senior law enforcement official said.
At least 8,000 spores must be inhaled into the lungs to get the most deadly form of anthrax. Substantially fewer spores can cause the highly treatable cutaneous form of anthrax if they enter a cut in the skin.
Inside the iron gates at 1600 Pennsylvania Ave. regular biohazard testing has been stepped up in the past month and no traces of anthrax have been found, said presidential spokesman Ari Fleischer.
Security officials were apparently spooked even before Tuesday’s discovery at Bolling, which handles mail processed through the Brentwood postal facility, and halted mail delivery to the White House complex several days earlier.
“We have not seen mail in a while,” said a West Wing aide. A staffer on campus at Bolling, in southeast Washington, said the same was true there.
Two postal workers at Brentwood died of pulmonary anthrax – one on Sunday, the other on Monday.
Brentwood is where the anthrax-laced letter to Senate Majority Leader Tom Daschle was first handled.
The Bolling facility, which also handles mail to the Secret Service, “has been closed for further testing and decontamination,” Fleischer said. All employees there and in mailrooms within the White House complex – which includes the mansion, its East and West Wings, and the Eisenhower Executive Office Building – were being tested for exposure to anthrax.
In a statement, the Secret Service said no one connected with the mail facility at Bolling has reported anthrax-like symptoms.
Postal and health officials have said it’s possible for one anthrax-tainted letter to contaminate another, meaning the anthrax found on the Bolling machinery could have come from a letter that mixed with other mail at Brentwood.
Experts believe it unlikely that a cross-contaminated letter would have contained enough anthrax to make someone sick.
Fleischer said a sweep of the Bolling facility turned up a “positive culture” around 12:30 p.m. Tuesday.
Given that the U.S. Capitol, network TV news anchors and media companies had already been targeted by anthrax-tainted letters, an attempted attack on the White House was almost to be expected, Fleischer said.
“There is no other target, unfortunately, like the president. … The White House has always, unfortunately, been a target – a target for terrorists, a target for people who have shot at the building,” he added.
At the Treasury Department next door, recent anthrax scares prompted officials to shut down a first-floor mail room and move all mail reception and screening to an annex across the street.
DXer said
FLEISCHER: What happens typically on these type of tests is there’s something called a fast ticket, which is a very fast way to measure for the presence of anthrax and it very often leads to false reports — either false positives or false negatives. The most reliable tests are culture tests and culture tests take time. That’s where they place a sample in what I believe is a Petri dish or put it under a microscope and then they analyze it to see what grows. That’s a period of time to determine whether it grows. That is the most reliable test.
That test was taken by the Secret Service. That test came back conclusively positive. That is that it came back conclusively positive showing trace amounts of anthrax on the slitter. I’ve said that repeatedly. There’s no change in that. It’s trace amounts.
Note: At the time, other reporting indicated that the number of spores was found to be 20 and 500 spores.
Ike Solem said
DXer says,
“If you feel the NAS is in violation of the law, find a firm in DC that will take on the issue pro bono and bring suit.”
That’s ridiculous, DXer – the problem here with the NAS committee goes far beyond the release of FBI documents -it’s that they are not asking the right questions, and they are not calling the right witnesses.
Secondly, if all you know about science is one week in the fourth grade, why are you repeatedly claiming that the spores could have ended up coated with silica due to the growth media? That’s pure nonsense – and the FBI must know this as well (or they would if they bother to read this blog). I’ve personally contacted the FBI contract office for the NAS committee, and they won’t even tell me who the technical FBI liason to the NAS committee is, by the way… except that it’s a “she” who “doesn’t want to talk to me.” Hey, I’d love to sit down with the FBI lab rats and thrash this out – but I think that they know they don’t have a foot to stand on on this, as do all the other scientists who’ve been involved in this farce. The anthrax trick is not basement chemistry; Ivins didn’t have the means, and their case against him is ludicrous, one that even a rookie lawyer could demolish with his eyes closed – with a tiny little bit of technical assistance.
In fact, the only similar type of mishandling of an anthrax outbreak in recent history that I can think of is that of Sverlovsk, 1979 – and how did the Soviets try to cover up their Sverdlovsk incident? The similarities are remarkable – here’s the quote from the Guillemin book:
Later, in October of that year, a delegation to Moscow from the U.S. National Academy of Sciences, chaired by Joshua Lederberg, heard the physician’s case, in both a formal presentation and informal discussion. Following that, in 1988, with Matthew [Meselson] handling the arrangements, two of those Soviet physician came to the Unites States to present and defend their government’s explanation of the 1979 anthrax outbreak. They spoke to professional audiences at the National Academy of Sciences in Washington, the John Hopkins School of Public Health in Baltimore, and the American Academy of Arts and Sciences in Cambridge. Their detailed presentation of the infected-meat scenario was judged plausible, although it lacked substantive clinical and epidemiological evidence.
You see, there’s nothing like putting nonsense in the mouths of “respected independent scientists” to convince the gullible.
Ken Alibek, however, after defecting from Biopreparat reports something rather different…
Lepyoshkin noticed my glances and began to grin.
“Kolya!” he said, turning to Chernyshov. “Why don’t you tell our commander Kanatjan what you have done?”
“Go on, tell me,” I said with a smile, enjoying our camaraderie. “I won’t punish you.”
I thought Chernyshov might have committed some embarrassing blunder in the lab. He was an experienced scientist; I couldn’t imagine it was anything serious.
Chernyshov turned beet red. He kept sipping his tea and refused to talk.
Lepyoshkin was enjoying himself too much to hold back.
“Have you heard about the Sverdlovsk accident?” he asked me.
By then, of course, I had.
“Do you know who was responsible?”
“Who?”
“You’re sitting across the table from him.”
I stared at Chernyshov in disbelief. His face was riveted on an invisible spot in front of him, and his hands began to shake so violently that he had to put his teacup down. He looked as though he was about to burst into tears.
Lepyoshkin began to describe what had happened that March afternoon in Sverdlovsk. Chernyshov didn’t try to deny a thing. He refused to say a word.
His friend kept smiling. “So, now you know: this is the guy who killed all those people.”
Chernyshov finally got up and walked out….
It only gets better – because there is always a reason these things get swept under the rug, you know:
For the good of our biological warfare program, Chernysov’s mistake had to be kept quiet. A thorough investigation of what had happened in Compound 19 would raise too many awkward questions even inside our own government about our activities. This was further proof that secrecy was valued above all else in our system – even if it endangered our own safety.
What did our eager little scientist do? Forgot to replace the air filters on the containment system in the anthrax production line – and this wasn’t spray dried anthrax, just the crude milled variety, which is probably why the deaths were limited to under a hundred. If it had been the stuff used in the Daschle-Leahy letters, thousands might have died as a result.
Even more curious is what Alibek states later, particularly in light of the U.S. anthrax letters:
In the West, an accident of such magnitude would have been investigated ad nauseam and it lessons distributed, however quietly, to those working in similar areas. Our coverup virtually guaranteed further disasters.
Wow! How curious – I’ll leave it as an exercise for the reader to draw the obvious parallels to the 9/18 and 10/9 anthrax attacks, which – although the fatality levels were lower – were clearly DELIBERATE in nature, not accidental. However, I see that DHHS Secretary Sebelius has managed to push through executive approval for the $1 billion biowarfare facility for Kansas… in order to keep us safe from the anthrax terrorists, I suppose. Look it up. Foot-and-mouth disease and other plant and animal pathogens are at the top of the list… what would be the consequences of an accidental release from that site? Sebelius – what a disaster!
Even more revealing was the behavior of the Soviet general in charge of Sverdlovsk…vis-a-vis the facts…
At the time, it didn’t matter to me whether Americans were told the truth or not, but I thought Burgasov’s [the Soviet scientist sent to the U.S. in 1988] account would never pass muster with any self-respecting epidemiologist. How could anyone believe that people would go on eating “contaminated” meat for weeks after the first victims fell sick? The story might explain a few deaths, but not an epidemic. And how could they explain that the majority of the victims were adult males? Didn’t women and children eat meat?
Indeed…
Can you tell me, General,” I said, “what the real cause of the Sverdlovsk accident was?”
“Contaminated meat,” he said at once…
“Listen,” he said, “If you think you know what caused this thing that’s your business, but never ask me what happened. Each time you ask, my answer will always be ‘contaminated meat.'”
I refused to sign off on the paper, believing it would make us look foolish abroad. Burgasov was furious. “Tell that young man to write his own paper,” he fumed at Kalinin, who impolitically passed the remark along to me.”
Yes, that’s how things were done in the old Soviet Union…cough.
I think the National Academy of Sciences Committee is following in their footsteps, DXer, don’t you? The similarities are remarkable – find some “independent scientists” to run with the party line… and believe me, what they’ve released so far is indeed farcical (with the exception of Paul Keim’s very clear and accurate testimony, which has no or little bearing on the FBI case, just on the identification of Ames – and which the committee attempted to attack, while nodding along with other nonsense) It’s even hard to transcribe, it’s so ridiculous – kind of nauseating, really, listening to the meaningless word blizzard – just talk faster, then it will all make sense!
They should just re-instate the Congressional investigation, or tell the NAS to set up a new committee – one not weighed down with Soviet-style conflict-of-interest issues.
DXer said
Ike Solem said
January 16, 2010 at 6:14 am
DXer says,
“If you feel the NAS is in violation of the law, find a firm in DC that will take on the issue pro bono and bring suit.”
That’s ridiculous, DXer”
Why is it ridiculous to find a firm or nonprofit to bring a suit pro bono to vindicate FOIA? And why do you think it is persuasive advocacy to dismiss a point with the word rather than addressing the substance of the suggestion. If you want to vindicate the rule of law, that is how enforcement of FOIA is done when jawboning has proved unsuccessful. An award of attorneys fees is governed by the statute. One FOIA expert on biodefense issues points to Public Citizen as being the toughest kid on the block — having litigated a FOIA issue to the US Supreme Court recently and prevailing. CSPI also does great work more generally and has been active on the issue of conflict of interest at the NAS — which, though, is not an issue applicable here as to the panel members. (You’ve made the claim it is but cite no factual support for it).
By way of example, I organized a dozen law firms to sue 10 of the largest soda companies in a pro bono effort focused on getting soda out of high schools and benzene out of soda and it didn’t cost me a dime. And FDA Commissioner Lester Crawford immediately resigned upon me contacting him about the benzene in soda by email — without me even being out the cost of a postage stamp. It is never ridiculous to vindicate the rule of law on a matter affecting public health. Lew is a high-powered guy who would think nothing of enlisting a top non-profit to bring suit and there has already been discussion of which organization would be best suited. Lew and I work closely together — think of us a right-left, mixing it up so as to land one on the jaw.
But I would be glad if you continue to press the NAS for documents by calling their legal department and explaining to them that FACA/FOIA does not have an exemption that contemplates withholding pendency of the review. And if the NAS thinks they do, the General Counsel should put his reasoning in a letter — citing the exemption he thinks permits the delay in production. Asking to be put in touch with the FBI liaison, OTOH, is unrealistic and is not contemplated by the procedure. On the substance, you can file a comment and it will be put in the public record. Do not allege a conflict of interest on the part of panel members without citing a factual basis or you will lose credibility.
On the merits, I just had an hour long talk with Dr. Spertzel, for example, last night. He has avoided talking about the matter 5 years and is not following things — to include the FBI’s report that Si and O was found in the coat. He was not aware of that and thought that they were just in the position of seeming to deny the AFIP finding that Si and O was detected.
You do not appear to have read the Murrell Chapter which the FBI would point to as necessary to understand the natural tendency of the spore coat to absorb silicon. The interpretation of the Si and O as silica is not necessary to resolve.
Microencapsulation = coating (although Ed does not appreciate this).
The reason I think the Si and O, in whatever form, (as distinguished from silica), could have ended up in the coating is that is what was, in fact, detected. That is the FBI WMD’s Chief’s conclusion. That is what happens when the microencapsulation patent is used. That is what happened when the air force lab did its experiment. Dr. Kiel sent SEMS that looked the same as the Leahy product when he used a silanizing solution in the slurry. He says that it would not be for the purpose of floatability. The DOD, if it likes, can obtain the Kiel product and ascertain the location of the Si and O.
As I understand it, microencapsulation can be done by either a chemical method OR using a dual nozzle spraydryer. Dr. Alibek’s point would be that a sophisticated product can result from simple methods.
And so what expert are you relying on in saying that a silicon microencapsulation method is not evidenced by the Si and O detected in the spore coat?
What controlled tests? Why haven’t you done controlled tests using the scientific method? Or recruited someone to do it?
You point to the Sverdlosk cover-up (which did, in fact, extend over many years). There was press reporting that got it right out early on but the official explanation continued and Dr. Meselson signed on.
In looking for hold-back or misleading information on the part of the official explanation, I would suggest you consider Dr. Spertzel’s hearsay report that there were 4 additional letters recovered.
Relatedly, consider how David L. Hose, a contractor who worked in the pouch and incoming mail unit, contracted inhalational anthrax. He was a supervisor at a contractor. Although commonly described as working at a mail sorting facility in Sterling, it was a State Department unit for handling incoming mail. Pouch and incoming mail. (The FBI’s explanation is that the wrong zipcode was used on the Leahy letter and that the person in the State Department mail sorting unit was affected by cross-contamination.
But then view the David L. Hose case in the context of the incident involving mail sorting of White House mail. Was anthrax was found on a slitter for mail coming to the White House at the same time?
Hold-back about 4 letters, if the rumor were substantiated, would be very dramatic. I think it would make an Ivins Theory all the more untenable insofar as the particular arguments made about the time he had on those evenings, the fact that the fermenter motor was seized etc.
“Later, in October of that year, a delegation to Moscow from the U.S. National Academy of Sciences, chaired by Joshua Lederberg, heard the physician’s case, in both a formal presentation and informal discussion.”
Yes, I pointed to the NAS consideration of Sverdlosk many months but was not able to get details on the proceedings (that I recall). It would be a fascinating subject and I urge you to find the proceedings (or submit a request to their information people). On the merits, you should submit your comments to the record if you like and they will made available to the public who request them. Asking for the Sverdlosk proceeding record is part of the process and should be done by someone. I would be glad to post the formal opinion just as I arranged with Lew to post the powerpoints obtained by Anonymous Scientist from the NAS. I am sure he would be glad to post a formal opinion by you so that it can then be compared with what the FBI experts say and the NAS report that results.
Specifically, I would ask why you think that the method of silicon microencapsulation used in bioweaponeering is not indicated.
“Following that, in 1988, with Matthew [Meselson] handling the arrangements, two of those Soviet physician came to the Unites States to present and defend their government’s explanation of the 1979 anthrax outbreak. They spoke to professional audiences at the National Academy of Sciences in Washington, the John Hopkins School of Public Health in Baltimore, and the American Academy of Arts and Sciences in Cambridge. Their detailed presentation of the infected-meat scenario was judged plausible, although it lacked substantive clinical and epidemiological evidence.”
There are some people, like the pathologist in Russia who my friend interviewed, who would say it was not plausible at the time Dr. Meselson made the argument. He relied on the narrow geographic range of those affected – in a narrow plume – in later changing his view. (Query why such data was not the focus from the very start in the early years). But he would not have been working with US defense — internal documents show that they were incredulous at one meeting and after he left the room commented that he was not asking the hard questions. The DIA meeting notes are available online at the national security archives.
“You see, there’s nothing like putting nonsense in the mouths of “respected independent scientists” to convince the gullible.”
Yes, later gullible folks even later rely on the book written by that scientist’s wife as you did.
US intelligence at a meeting of DIA and CIA personnel were as started by Dr. Meselson’s view and thought he was not asking the hard questions. Dr. Meselson would be a fascinating interview. He eventually published his account of his views on Sverdlosk and how they evolved. I encourage you to call him before he participates in the rewriting of the history of Amerithrax.
“Ken Alibek, however, after defecting from Biopreparat reports something rather different…
Yes, Ken was officially tasked by his superiors in charge of orchestrating the deception at Sverdlosk. I started my questioning of Ken (and he would respond) over a 5 years ago. The reason to get people on the record is not to establish the facts as such but do get them on the record so things might be sorted out. He is the inventor of the microencapsulation patent that I point to in explaining why the FBI suspected the man 15 feet away from Ken, a scientist who was coordinating with the 911 imam. Quoting someone with opposing interests making the same point is the best way to remove it from contention. So given that he would be sensitive to civil liability on the issue, it was useful for him to be the one to tell me that the FBI suspected Dr. Al-Timimi rather than for me to be the one to tell him.
The air force scientist who I rely on as an expert on the Si-O signature, who conducted controlled experiments using anthrax simulant, says the Alibek patent is a microencapsulation patent. Such a patent uses the silica to increase viability over a wide range of pathogens. See 2000 PLAGUE WARS read by Ayman Zawahiri. That book relied on interviews of Dr. Alibek and Dr. Bailey, the Battelle consultants from 1999.
So you and I have been on the same page. I’m just reading ahead.
The military expert I rely upon says the Silicon Signature could have resulted from a silanizing solution or some other silica-related substance used prior to drying that had functionality for the purpose of bioweapons apart from floatability. Floatability results from the purification in liquid form combined with the charge. The product made without the silanizing solution had the same floatability.
The Sandia experts were expert at identifying the location of the Si and O. After identifying the location of the Si and O, their work was/is done. Opining as to the reason for the Si and O would be beyond their field and data.
Dr. Spertzel is not following the matter closely and was unaware that the FBI is urging that Si and O in fact was detected. By analogy, years ago, Dr. Alibek was unaware that AFIP had detected Si until I told him. His point was simply that it does not necessarily point to a state process. And Dr. Meselson’s point is that even state know-how travels in the mind of individuals. Both of them are correct.
As the top expert the NAS should hear, I would recommend Dr. Kiel given that he did controlled experiment in making an anthrax simulant in a principled and scientific attempt to resolve the question.
But I would ask that you contact experts and provide their opinion. As I said, Dr. Spertzel was not aware that the FBI was reporting that Si and O was in the coat. Which is where it would be if the dual purpose/ weaponization process of microencapsulation was used. And Dr. Kiel does not support your view, he supports my view. So I’m not aware of what named experts you rely upon. If you disagree with me that the bioweapons method of silicon microencapsulation was used, I’d be glad to be educated by your views. You could also submit it for the record to the NAS.
I solicited the written opinion of BHR. She points to the same patent I do.
I solicited the written opinion of Dr. Popov. I don’t find any support for your view in his opinion — just expert support for opposing the FBI’s Ivins Theory. And expert support for opposing the view that the Si and O just happened without being intentionally added.
Dr. Alibek’s assistant Crockett pointed to this encapsulation method and the reason for it in her PhD thesis on the mailings in a passage I’ve often quoted. She was two doors down from Ali Al-Timimi.
DXer said
Dr. Rosenberg’s Fall 2008 analysis in footnotes 21 and 22 refers to U.S. Pat. App. # 09/805,464 by Charles Bailey and Ken Alibek, March 14, 2001. The patent (#6,649,408) was issued on Nov. 18, 2003.
It uses hydrophobic silica in the culture medium.
It is a microencapsulation patent. See Plague Wars, Dr. Ayman Zawahiri’s resource reference according to the materials produced and cited in Science, in the appendix to the article about the perils of scientific openness.
I solicited and published the detailed written opinion of Serge Popov (responding to the BHR analysis) and he said the suggestion was hypothetical.
So what expert do you rely on in arguing that the Si and O signature could not have been the result of this method?
DXer said
Nag, nag, nag. It’s been explained that FACA is enforceable through APA. If you feel the NAS is in violation of the law, find a firm in DC that will take on the issue pro bono and bring suit.
But it’s an ongoing criminal investigation and these experts are helping the FBI out. So no judge is going to feel moved notwithstanding noncompliance given that there is no exemption “pending NAS review.” Besides, by the time the case is heard the NAS will have issued its report. So leave this poor Bill fellow alone given how many important matters the NAS handles.
The entire review as to Amerithrax is pretty much irrelevant as it does not go to the pertinent issues. For example, the genetics narrows things from 1,000 to 300. Big whoop. The Silicon Signature doesn’t exclude anyone. The iron and tin signature tends to exclude Ivins. etc. They did not even include within the scope of their review more probative matters — such as the Federal Eagle stamp issue. And did not include issues that had been central to the microbial forensics but in the end did not support its Ivins Theory and thus was deemed not “relevant.”
All I know about science relates to one week in to a Fourth Grade science project. But even to me it doesn’t strike me as a rigorous scientific review.